- Volume 70 , Number 4
- Page: 250–9
Profiles of the mRNA expression by macrophages infected with Mycobacterium leprae and Mycobacterium avium complex
ABSTRACT
In the present study, we examined profiles of the interaction of Mycobacterium leprae and Mycobacterium avium complex (MAC) with murine peritoneal macrophages (MΦS) in terms of up-regulation of MΦ expression of proinflammatory and im-munosuppressing cytolines (CKs) after infection. First, the reverse transcription polymerase chain reaction (RT-PCR) assay revealed that both MAC and M. leprae infections up-regulated MΦ mRNA expression IL-12. TNF-α, IL-10, and transforming growth factor-β (TGF-β). except that M. leprae-infected MΦs showed no increase in the IL-12 mRNA expression. Second, the RT-PCR assay also showed some differences between M. leprae- and MAC-infected MΦs with respect to the modes of IL-10 and inducible nitric oxide synthase (iNOS) mRNA expression. That is MAC, but not M. leprae, infection caused a prolonged increase in the expression of IL-10 and iNOS mRNAs. Third, a ribonuclease protection assay revealed that MΦs co-infected with MAC and M. leprae showed the IL-12. TNF-α and IL-10 mRNA expression in an intermediate mode of those of MΦs infected with either M. leprae or MAC alone. This implies that the CK expression of M. leprae-infected MΦs may be modified by co-infection with MAC. These findings may suggest differential interactions of M. leprae and MAC organisms with murine peritoneal MΦs in terms of the activation of signal transduction pathways for expression of some kinds of im-munoregulatory cytokines and immuno-protective enzymes.RÉSUMÉ
Dans cette étude, nous avons examiné les profils d'expression des cytokines (CKs) pro-inllammatoires el immunosuppressives issus de rinteraction de Mycobacterium leprae et du complexe de Mycobacterium avium (MAC) avec des macrophages murins (MΦs), en terme d'augmentation de I'expression d'ARNm des CKs des macrophages après infection. Premièrement, l'essai de transcription inverse suivie de réaction de polymerase en chaîne (RT-PCR) a montré que l'infection tant par MAC et que par M. leprae augmentait l'expression de IL-12. TNF-α. IL-10 et du facteur décroissance induisant la transformation de type β (TGF- β. sauf que les macrophages infectés par M. leprae n'ont pas montré d'augmentation de l'expression de l’ARN m de l’IL-12. Deuxièmement, l'essai de RT-PCR a aussi montré linéiques différences entre les MΦs infectés par M. leprae et les MΦs infectés par MAC en ce qui concerne les modes d'expression de l’ARN-m de l'IL-IO et de la synthetase induclible du monoxide d'azote (iNOS). Plus précisément, l'infection par MAC. mais pas M. leprae, provoque une augmentation prolongée des taux d'ARNm de l'IL-10 et de la iNOS. Troisièmement, un essai de protection contre la digestion par les ribonucléases a révélé que les MΦs coinfectés par MAC et M. leprae montraient un niveau intermédiaire d'expression des ARNm de I'IL-12. de TNF-α et de 1’IL-10 par rapport à ceux exprimés dans les MΦs infectés par M. leprae ou MAC seuls. Ceci implique que l'expression des CKs des MΦs infectés par M. leprae peut être modiliée par une coinlection avec MAC. Ces données suggèrent une interaction différentielle de M. leprae et des micro-organismes du MAC avec les MΦs péritonéaux de souris au niveau des voies de transduction des signaux intracellulaires pour l'expression de certaines cytokines immunorégulatrices et d'enzymes induisant une immunoprotection.RESUMEN
Se infectaron macrófagos peritoneales mininos con Mycobacterium leprae y Mycobacterium avium complejo (MAC), y se examinaron los perfiles de expresión de citocinas (CKs) proinflamatorias e inmunosupresoras consecuentes a la infección. Primero, la reacción en cadena de la transeriptasa reversa (RT-PCR) reveló que tanto la infección por MAC como por M. leprae, sobreactivaron la expresión de los mRNAs para IL-I2, TNFα, 1L-10. y el factor β del crecimiento transformante (TGF- β). También se observó, que a diferencia de los macrófagos infectados con MAC, los infectados con M. leprae no mostraron ningún incremento en la expresión del mRNA para IL-I2. Segundo, el ensayo de RT-PCR mostró algunas diferencias entre los macrófagos infectados eon M. leprae y MAC con respecto a los modos de expresión de los mRNAs para IF-10 c iNOS. Concretamente, la infección por MAC. pero no por M. leprae, causó un incra-incnto prolongado en la expresión de los mRNAs para 11.-10 e iNOS. Tercero, un ensayo de protección de la ribonucleasa reveló que los macrófagos co-infectados con MAC y M. leprae, mostraron un patrón de expresión de los mRNA para 1L-I2. TNFα, e IL-10, intermedio entre los patrones mostrados por los macrófagos infectados con los microorganismos por separado. Esto implica que la expresión de CKs por los macrófagos infectados con M. leprae, puede ser modificado por la co-infección con MAC. Los resultados sugieren que M. leprae, y MAC interaccionan de manera diferente con los macrófagos mininos y que esto se refleja en la activación de diferentes vías de señalización relacionadas con la síntesis de citocinas inmunorrcgulado-ras e inmunoprolectoras.Profiles of cytokine (CK) expression in the hosts infected with Mycobacterium leprae have been actively investigated. In particular, Modlin and his colleagues demonstrated that mRNA encoding Th1 CKs, including IL-2, IFN-γ, and lymphotoxin were detected at higher levels in tuberculoid lesions, but virtually absent in lesions of lepromatous leprosy patients. In contrast, Th2 CKs, such as IL-4. 1L-5. and EL-10 mRNAs, were present at higher levels in lepromatous than in tuberculoid lesions (15,30,33). IL-12 produced by macrophages (MΦs) infected with M. leprae facilitates a Th1 response, which is closely associated with cell-mediated immunity against M. leprae antigens, acts by activating NK cells to release IFN- γ, which in turn activates Th1 cells in collaboration with DL-1.2 (16-26-30). In the case of the host immune response against M. leprae, IL-12 and IL-18 produced by M. leprae-infected MΦs display collaborating effects in eliciting a Th1 response (10,13). Moreover, IL-7 and IL-15 produced by infected MΦs also facilitate T-cell activation and expansion in response to M. leprae antigens (11-25). On the other hand, IL-10 produced by MΦs and IL-4 produced by Th2 cells, NK1.1+T cells, or CD 19V B220+B cells suppress the Th1 response, but facilitate the Th2 response against M. leprae antigens (15- 24). Moreover. MΦ-derived IL-10 and transforming growth factor-β (TGF-β) are known to down-regulate MΦ antimycobacterial activity (7-x). It is, thus, conceivable that M(|)s determine the host immune response against M. leprae infection, not only by acting as antigen processing cells or bactericidal phagocytic effector cells, but also by producing various kinds of immunoregulatory CKs.
Mycobacterium avium complex (MAC) has been reported to resemble M. leprae both taxonomically and biologically as follows. First, MAC and M. leprae arc highly related and form a phylogenically tight cluster apart from other mycobacterial species, including slow growers and rapid growers (27). Second, although most M. leprae antigens have close homologs in the Mycobacterium tuberculosis complex (28), the homolog of the 35-kDa antigen of M. leprae is found in MAC only (31). Third, electron microscopic studies showed that, after the entry of MAC, as well as M. leprae into host cells, including MΦs and epithelial cells, the electron transparent zone (ETZ) consisting of bacterial mycosides starts to form and surrounds these bacilli inside phagosomes (l8-20). The presence of an ETZ is considered to play a crucial role in bacterial resistance to the action of bactericidal effectors provided in phagolysosome vesicles (19). In addition, MAC organisms are frequently isolated from human lepromas. It has been reported that co-infection of MAC with M. leprae increases the pathogenicity of leprosy bacilli and facilitates the progression of the disease in vivo, presumably enhancing metabolic activity of the organisms (12).
These situations encouraged us to investigate profiles of the interaction of M. leprae and MAC with host MΦs in terms of CK expression by MΦs. In the present study, we have found some differential modes of CK mRNA expression of MΦs infected with M. leprae or MAC.
MATERIALS AND METHODS
Microorganisms. M. leprae Thai-53 strain was harvested from infected footpads of BALB/c nude mice, and bacterial suspensions were prepared as follows (21). The infected footpads were homogenized in Hanks' balanced salt solution (HBSS) containing 5% fetal bovine scrum (FBS) and centrifuged at 200 x g for 5 min. The upper layer was saved and the bacilli were collected by recentrifugation at 1500 x g for 15 min. The bacterial suspension was again centrifuged at 200 x g for 5 min, to remove bacterial clusters and the upper layer (about 90% volume) was harvested. The resultant bacterial suspension was then treated with 0.1 N NaOH for 1 min. neutralized with 0.1 N HCI, centrifuged at 1500 x g for 15 min. The resultant sediment was suspended into 10 ml of RPMI 1640 medium, pronase-P was added at 0.5 mg/ml. incubated at 37°C for 2 hr, and the pronase-P reaction was stopped by the addition of bovine serum albumin (BSA) at 0.7%. After washing twice with phosphate buffered saline (pH 7.2) containing 0.1% BSA by centrifugation, the resultant bacterial pellet was suspended into RPMI 1640 medium supplemented with 10% FBS. The viability of M. leprae organisms before and after pronase-P treatment was determined by the fluorescein diacetate/etIndium bromide (FDA/EB) staining according to the method of Tsukiyama, et al. (32). The percentage of green-stained viable cells in the M. leprae preparation before and alter pronase-P treatment was estimated as 87.5 ± 1.2% and 86.2 ± 1.4% (n = 3). This indicates that pronase-P treatment did not cause severe damage in the cell surface of the M. leprae organisms.
Virulent SmT variant of MAC N-260 strain, showing smooth, transparent and irregularly-shaped colonies and avirulent SmD variant, showing smooth, opaque, and dome-shaped colonies (6) were used. MAC N-260 strain was identified as M. intracellulare by a DNA probe test, and determined to belong to serovar 16 by an agglutination test. MAC organisms were grown in Mid-dlebrook 7H9 medium and bacterial suspensions prepared with 0.1% BSA-PBS were frozen at -80°C until use. Before use, the bacterial suspension was centrifuged at 200 x g for 5 min to remove bacterial clumps.
Expression of cytokine mRNA by M. leprae- or MAC-infected MΦs. MΦ monolayer cultures prepared by seeding 5 x 106 peritoneal cells of 8- to 12-week-old male BALB/c mice on 60 mm culture dishes were incubated in 5 ml of 10% FBS-RPM1 1640 medium at 37°C for 48 hr in a CO2 incubator (5% CO2-95% humidified air). After washing with Hanks' balanced salt solution (HBSS) containing 2% FBS, the MΦs were cultured in 5 ml of the medium containing 1 x 107 bacilli/ml (CFU/ml for MAC) of test organisms at 37°C in a CO, incubator for up to 24 hr.
At intervals, cultured MΦs were harvested and reverse transcription (RT)-PCR analysis of the mRNAs expression of test CKs (IL-12 p40. TNF-α, IL-10, TGF-β), inducible nitric oxide synthase (iNOS), and ICAM-I in the MΦs was performed as described previously (21) with slight modifications. Total RNA was isolated from the MΦs using the ISOGEN kit (Nippon Gene Co., Toyama, Japan). After deoxyribonuclease-I (DNase-I) (GIBCO BRL Co., Rockville, Maryland. U.S.A.) treatment (1 unit DNase-I/µg of RNA sample) at room temperature for 15 min, the resultant RNA samples were reverse transcribed to the hist chain of cDNA using oligo dT primers (GIBCO) and 200 units Superscript II reverse transcriptase (GIBCO) with the standard reaction mixture (20 µl): 1 x reverse transcriptase (RT) buffer (pH 8.3), 1 mM each dNTP including dATP, dCTP, dGTP and dTTP (GIBCO), and 2.0 units of ribonuclease inhibitor (GIBCO). After 1-hr reaction at 42°C and subsequent heating at 72°C for 15 min. I ul of aliquots of resultant cDNA were amplified specifically by PCR in the standard reaction mixture (50 µl) containing 1 x PCR buffer (pH 8.3), 0.2 mM of each dNTP, I unit of Taq polymerase (Tikara Biomedicals Co., Tokyo. Japan), and 20 pmoles of sense and antisense primers for test proteins (synthesized by Greiner Labortechnik Co., Tokyo, Japan) as follows (sense/antisense): IL-12 p40 (CGT GCTCATGGCTGGTGCAAAG/CTTCAT CTGCAAGTTCTTG GGC); TNF-α (AG CCCACGTCGTAGCAAACCACCAA/AC ACCCATTCCCTTC ACAGAGCAAT): IL-10 (TGACTGGCATGAGGATC AGCAG/ATCCTGAGGGTCTTCAGCTT); TGF-β1 (AGCCCTGGATACCAACTATTGCTTCA GCTCCACAG/AGGGGCGGGGCGGGG CGGGGCTTCAGCTGC); iNOS (CCTGC TCACTCAGCCAAG/AGTCATGGAGCC GCTGCT); and ICAM-I (CAGGAGAGC ACAAACAGCAGTG/AGAGCGGCAGA GCAAAAGAAGC). Reactions were carried out in a DNA Thermal Cycler (ASTEC Corp., Fukuoka, Japan) for 25 cycles including denaturing at 94°C for 1 min, annealing at 58°C for 2 min, and extension at 72°C for 2 min for each cycle. PCR products were analyzed by electrophoresis on ethidium bromide-stained 2% agarose gels.
In some experiments, CK mRNA expression by MΦs was measured by the ribonu-clease (RNase) protection assay using Ribo-quantTM Multi-Probe RNase Protection Assay System (Pharmingen Co., San Diego, California, U.S.A.) according to the manufacturer's instruction manual. In this study, mCK-2b and mCK-3 mouse cytokine multi-probe template sets were used for measurement of cytokine mRNAs as follows: mCK-2b: EL-10 and 1L-12 p40 mRNAs; mCK-3: TNF-α and TGF-β mRNAs.
RESULTS
Expression of CK mRNAs by M. leprae-infected MΦs. The time-course of the expression of IL-12, a proinflammatory CK TNF- α, and immunosuppressive CKs (TL-1.0, TGF-β) in MΦs stimulated with M. leprae infection was examined by the RT-PCR assay. Fig. 1 shows the profiles of the mRNA expression of these CKs by MΦs during chase cultivation after M. leprae infection. IL-12 p40 mRNA expression was not observed for MΦs at least during 24-hr cultivation after infection. Second, TNF-α mRNA expression was remarkably increased at 3 hr after infection, and thereafter, gradually declined until 24 hr. The TNF- α mRNA expression was at a considerably high level even at 24 hr. Third, IL-10 mRNA expression was somewhat increased at 3 hr after infection, and, thereafter, rapidly ceased, reaching an undetectable level by 12 hr. Fourth, TGF-β mRNA expression was slightly increased at 3 hr after infection, followed by a gradual decrease reaching the normal level at 24 hr. Notably, the IFN-γ (500 units/ml) treatment yielded no obvious change in the modes of CK mRNA expression of M. leprae-infected MΦs (unpublished observation).
Fig. 1. Expression of IL-12 p40, TNF-α, IL-10, and TGF-β mRNAs by MΦ infected with M. leprae. The relative intensities of the RT-PCR bands of individual cytokines were calculated by normalizing to the intensity of the β-act in hand. The values in parentheses are cytokine hand/β-actin hand ratios.
Expression of CK mRNAs by MAC-infected MΦs. Fig. 2 shows MΦ mRNA expression profiles measured by the RT-PCR assay of IL-12, TNF-α, IL-10, and TGF-β after infection with MAC organisms with different levels of virulence, a virulent SmT variant and an avirulent SmD variant. The mRNA expression of IL-12 p40 was increased in MΦs infected with MAC SmT variant as well as in those infected with MAC SmD variant at 3 hr after infection. The mRNA expression, thereafter, gradually decreased, and almost disappeared at 24 hr. Second, TNF-α mRNA expression was markedly increased at 2 hr after MAC SmT as well as MAC SmD infection, and, thereafter, gradually declined until 24 hr. The intensities of TNF-α mRNA expression of MAC SmT- and MAC SmD-infected MΦs were nearly identical. Notably, intense expression was still seen for the TNF-α mRNA even at 24 nr. Third, IL-10 mRNA expression was increased at 3 hr after MAC SmT and MAC SmD infection. The mRNA expression was retained at the same levels during 3 to 6 hr, and, thereafter, gradually declined until 24 hr. Notably, IL-10 mRNA expression during 3 to 6 hr was much stronser in MAC SmD-infected M(j)s than in MAC SmT-infected MΦs. Fourth, TGF-β mRNA was constitutively expressed by uninfected MΦs. Both MAC SmT and MAC SmD infections caused a moderate increase in TGF-β mRNA expression at 3 hr, and the increased level of TGF-β mRNA expression was retained until 24 hr. In separate experiments, the increase in TGF-β mRNA expression lasted at least for 48 hr (data not shown). Similar levels of TGF-β mRNA expression were seen for M(j)s infected with MAC SmT and those infected with MAC SmD. Notably, the IFN- γ (500 units/ml) treatment yielded no obvious change in the modes of CK mRNA expression of MAC N-260-infected MΦs (unpublished observation).
Fig. 2. Expression of IL-12 p40, TNF-α, IL-10, and TGF-β mRNAs by MΦs infected with MAC SmT or SmD colonial variant. The other details are the same as those described in the legend of Fig.1.
Expression of CK mRNA by MΦs co-infected with M. leprae and MAC. It has been reported that co-infection of MAC with M. leprae increases the pathogenicity of leprosy bacilli and facilitates the progression of the disease in vivo (14). Thus, it is of interest to examine the mode of CK mRNA expression by MΦs co-infected with M. leprae and MAC. For this purpose, we measured the expression of IL-12, TNF-α, IL-10 and TGF-β mRNAs by MΦs co-infected with both organisms by the RNase protection assay. As shown in Fig. 3 and The Table, MΦs co-infected with both organisms showed the mRNA expression of IL-12, TNF-α, and IL-10 in an intermediate mode for those of MΦs infected with either M. leprae or MAC alone. The levels of IL-12 and IL-10 mRNA expression seen in MΦs infected with M. leprae alone were decreased due to co-infection with MAC, while the opposite phenomenon was observed for TNF-α mRNA expression. On the other hand, the level of TGF-β mRNA expression was somewhat decreased in MΦs co-infected with both organisms as compared with those of MΦs infected with each organism alone.
Fig. 3. Expression of IL-12 p40, TNF-α, IL-10, and TGF-β nfRNAs by MΦs infected with M. leprae or MAC alone or co-infected with both organisms. CK mRNA expression by MΦs was measured by the RNase protection assay. The rnRNA expression of L32, a housekeeping gene, was measured as the positive control of constitutive mRNA expression.
Expression of iNOS and ICAM-1 mRNA by M. leprae- and MAC-infected MΦs. Fig. 4 shows MΦ mRNA expression profiles of iNOS and an adhesion molecule ICAM-1 measured by the RT-PCR assay, when MΦs were infected with either M. leprae or MAC. MAC infection caused a marked increase in the iNOS mRNA expression by MΦs at 3 hr post infection, whereas M. leprae infection tailed to show such an effect. The increase in iNOS mRNA expression in MAC-infected MΦs lasted at least for 24 hr. Notably, MAC SmT-infected MΦs expressed stronger mRNA during 3 hr to 24 hr than did MAC SmD-infected MΦs. Second, ICAM-1 mRNA was constitutively expressed by uninfected MΦs. The mRNA expression of ICAM-1 was increased in MΦs at 3 hr after infection with M. leprae, as well as MAC SmT or MAC SmD, and, thereafter, gradually decreased until 24 hr. Similar levels of ICAM-1 mRNA expression were noted for MAC SmT- and MAC SmD-infected MΦs. These results on ICAM-1 mRNA expression are consistent with our previous findings concerning ICAM-1 expression in a protein level by M. leprae- and MAC-infected MΦs (23,30).
Fig. 4. Expression of iNOS and ICAM-1 mRNAs by MΦs infected with M. leprae or MAC. The other details are the same as those described in the legend of Fig. 1.
DISCUSSION
The present study revealed some differences in the profiles of MΦ expression of CK and other protein genes between M. leprae- and MAC-infected MΦs, as follows. Although weak but significant increase in the IL-12 p40 mRNA expression was noted for MAC-infected MΦs in the early-phase (3 hr) after infection, such a phenomenon was not observed for M. leprae-infected MΦs. The latter finding is enigmatic, since the important role of MΦ-derived IL-12 in the establishment of Th1 response in M. leprae-infected hosts has been well documented (14,16,26,29). Moreover, in the case of M. leprae infection in mice without immunodeficiency, bacterial growth at the sites of infection is well controlled due to strong expression of anti-M. leprae cellular immunity that is mediated by host Th1 cells in humans (14,16,29,33) and in mice (2,4,13). It appears that this strange situation may be attributable to our experimental conditions, particularly that we used murine resident peritoneal MΦs. That is, efficient production of IL-12 by M. leprae-infected MΦs may required additional stimulatory signals other than phagocytosis of the organisms. It is likely that priming of MΦs with certain stimulants, that is deficient in resident MΦs, may be prerequisite for the gene expression of IL-12 induced by engulfment of M. leprae organisms. Concerning this point, further studies are needed.
In the case of MAC-infected MΦs, the increased levels of IL-10 mRNA expression at 3 hr were maintained for long time periods after infection (at least until 24 hr). On the other hand, in the case of M. leprae-infected MΦs, IL-10 mRNA expression, which was increased at 3 hr post infection, rapidly declined, reaching the undetectable level by 12 hr. However, M. leprae infection caused a considerably stable expression of TNF-α and ICAM-1 mRNA for 24 In after infection. The instability of IL-10 mRNA expression in M. leprae-infected MΦs may be due to rapid down-regulation of the IL-10 mRNA transcription after 3 hr, rather than due to rapid decay of 1L-10 mRNA itself.
It has been proposed that immunosup-pressing cytokines, such as 1L-10 and TGF-β, play important roles in the establishment of persistent infections by pathogenic mycobacteria, including MAC and M. leprae, either by down-regulating MΦ antimycobacterial functions (7,8,24,29) or by attenuating mycobacteria-induced MΦ apoptosis coupled with the elimination of intramacro-phage organisms (5,17). However, as indicated in Fig. 1, the mRNA expression of these cytokines was not stronger in MΦs infected with virulent MAC (SmT variant) than in those infected with avirulent MAC (SmD variant). Notably, IL-10 mRNA expression of MAC SmT-infected MΦs was conversely much weaker than that of MAC SmD-infected MΦs. These findings suggest the possibility that neither IL-10 norTGF- β may play crucial roles in the mechanisms for bacterial escape from MΦ antimicrobial mechanisms. However, further in vivo studies are needed to reveal detailed profiles of the CK expression in granulomas of M. leprae-infected animals before such a conclusion is made.
Co-infection of MAC to M. leprae-infected mice is known to increase the pathogenicity of leprosy bacilli and facilitate the progression of the disease in mice (12). In the present study, it was found that MΦs co-infected with both M. leprae and MAC showed the CK mRNA expression (except for TGF-β in an intermediate mode of those of MΦs infected with either M. leprae or MAC alone. This implies that the CK expression of M. leprae-infected MΦ may be modified by co-infection with MAC. Notably, the IL-12 mRNA expression of M. leprae-infected MΦs at 3 hr after infection was reduced to less than half of the original level (ca. 60% reduction) due to MAC co-infection. Moreover, MΦs co-infected with both of these organisms failed to show durable expression of IL-12 mRNA, as observed in the case of MΦs infected with MAC alone during 3 hr to 12 hr after infection. Thus, it is implicated that anti-M. leprae. Th 1 response of host animals may be hindered due to co-infection with MAC. This may account for the increase in the pathogenicity of M. leprae, when M. leprae-infected mice were further co-infected with MAC organisms (12).
Although MAC-infected MΦs displayed markedly increased iNOS mRNA expression during 3 hr to 24 hr after infection, such an increase in the iNOS gene expression was not noted for M. leprae-infected MΦs. Notably, reactive nitrogen intermediates, including nitric oxide radical produced by iNOS, play crucial roles in MΦ antimicrobial mechanisms against mycobacteria, including M. tuberculosis, MAC, and M. leprae (1,3,9,22,30). It. thus, appears that the defect of M. leprae in inducing the iNOS expression by MΦs phagocytizing the organisms plays a favorable role for the organisms in escaping from MΦ antimicrobial mechanisms.
In summary, the present study revealed that there are noticeable differences in the modes of the mRNA expression of IL-12, IL-10, and iNOS in M. leprae-infected MΦs, as compared to MAC-infected MΦs. These findings may suggest differential interactions of M. leprae and MAC organisms with murine peritoneal MΦs in terms of the activation of signal transduction pathways for expression of some kinds of immunoregulatory cytokines and immuno-protective enzymes. Further investigations are needed to elucidate the precise meaning of these findings, in particular the studies using peritoneal MΦs, which are given priming with various stimulants before mycobacterial infection, or blood monocyte-derived MΦs. On this point, further studies are currently under way.
Acknowledgments. This study was supported in part by grants from the Ministry of Education, Culture, Sports, Science and Technology of Japan and the Ministry of Public Health, Labour, and Welfare of Japan.
REFERENCES
1. Adams. L. B., Job. C. K. and Krahenbuhi., J. L. Role of inducible nitric oxide synthase in resistance to Mycobacterium leprae in mice. Infect. Immun. 68 (2000) 5462-5465.
2. Adams, L.B.. Scollard. D.M., Ray. N.A., Cooper, A.M., Frank, A.A., Orme, I.M. and Krahenbuhl.. J. L. The study of Mycobacterium leprae infection in interferon-gamma gene-disrupted mice as a model to explore the immunopathologic spectrum of leprosy. J. Infect. Dis. 185 (2002). S1-S8.
3. Akaki. T., Tomioka. H.. Shimizu, T.. Df.KIO, S. and Sato, K. Comparative roles of tree fatly acids with reactive nitrogen intermediates and reactive oxygen intermediates in expression of the antimicrobial activity of macrophages against Mycobacterium tuberculosis. Clin. Exp. Immunol. 121 (2000) 302-310.
4. Backstrom. B. T, Harris, D. P., Prestidge, R. I. and Watson, j. d. Genetic control of immune responses to the 18-kDa protein of Mycobacterium leprae. Different TH1 subsets may be involved in proliferative and delayed-type hypersensitivity responses. Cell. Immunol. 142 (1992) 264-274.
5. Balcewkv.-Sablinska. M. K.. Gan. H. and Remold, H. G. Interlcukin 10 produced by macrophages inoculated with Mycobacterium avium attenuates mycobacteria induced apoptosis by reduction of TNF-α activity. J. Infect. Dis. 180 (1999)1230-1237.
6. Belisle, j. T. and Brennan, P. J. Molecular basis of colony morphology in Mycobacterium avium. Res. Microbiol. 145 (1994) 237-242.
7. Bermudez, L. E. Production of transforming growth factor-β by Mycobacterium avium-infected human macrophages is associated with unresponsiveness to IFN- γ. J. Immunol. 150 (1993) 1838-1845.
8. Bermudez, L. E. and Champsi, j. Infection with Mycobacterium avium induces production of interleukin-l0 (IL-10), and administration of anti-IL-10 antibody is associated with enhanced resistance to infection in mice. Infect. Immun. 61 (1993) 3093-3097.
9. Chan, j., Xing, Y., Magliozzo, R. S. and Bloom, B. R. Killing of virulent Mycobacterium tuberculosis by reactive nitrogen intermediates produced by activated murine macrophages. J. Exp. Med. 175(1992) 1111-1122.
10. Garcia, V. E., Uyemura, K., Sibling, P. A., Ochoa, M. T., Morita, Okamura, H., Kurimoto, M., Rea, T. H. and Modlin. R. L. IL-18 promotes type 1 cytokine production from NK cells and T cells in human intracellular infection. J. Immunol. 162(1994)6114-6121.
11. Jullien, D., SlELING P. A., uyemura, K., mar. N.D., Rea, T. H. and Modlin. R. L. 1L-15, an immunomodulator off cell responses in intracellular infection. J. Immunol. 158 (1997) 800-806.
12. Kazda, j., Fasske, E., Kolk, a., Ganapati, R. and Schroder. K. H. The simultaneous inoculation of Mycobacterium leprae and M. intracellular into nude mice: development of cutaneous leproma and acceleration of footpad swelling. Indian J. Lepr. 59(1987)426-343.
13. Kobayashi, K., Kai. M., Gidoh, M.. Nakata. N., Endoh, M., Singh. R. P., Kasama, T. and Saito, H. The possible role of interlcukin (IL)-12 and in-terferon-y-inducing factor/IL-18 in protection against experimental Mycobacterium leprae infection in mice. Clin. Immunol. Immunopharmaeol. 88(1998)226-231.
14. Modlin. R. L. Cytokine responses in leprosy lesions. Japan. J. Lepr. 64 (1995) 85 -88.
15. Modlin. R. L, and Nutman, T. B. Type 2 cytokines and negative immune regulation in human infections. Curr. Opiu. Immunol. 5 (1993) 551-517.
16. Ottenhoff, T. H. M. Immunology of leprosy: lessons from and for leprosy. Int. J. Lepr. 62 (1994) 108-121.
17. Pais. T. F. and Appelberg, R. Macrophage control of mycobacterial growth induced by picolinic acid is dependent on host cell apoptosis. J. Immunol. 164 (2000) 389-397.
18. Rastogi. N. ami David, H. L. Phagocytosis of Mycobacterium leprae and M. avium by armadillo lung fibroblasts and kidney epithelial cells. Acta Lepr. 2(1984) 267-276.
19. Rastogi, N. and David. H. L. Mechanisms of pathogenicity in mycobacteria. Biochimic 70 (1988) I 101-1120.
20. Rytkr, A.. Erehel, C, Rastogi, N. and David. H. L. Macrophage interaction with mycobacteria including M. leprae. Acta Lepr. 2 (1984) 211-225.
21. Sano. C, Shimizu, T., Sato, K., Kawauchi. H. and Tomioka, H. Effects of secretory leucocyte protease inhibitor on the production of the antiinflammatory cytokines. IL-10 and transforming growth factor-beta (TGF-p), by lipopolysaccha-ride-stimulatcd macrophages. Clin. Exp. Immunol. 121 (2000) 77 85.
22. Sato, K., Akaki. T. and Tomioka, H. Differential potentiation of antimycobacterial activity and reactive nitrogen intermediate-producing ability of murine peritoneal macrophages activated by inler-feron-gamma (IFN-y) and tumour necrosis factor-alpha (TNF-α). Clin. Exp. Immunol. 112 (1998) 63-68.
23. Shimizu, T. Maw, W. W. and Tomioka, H. Roles of tumor necrosis factor-α and transforming growth factor-β in regulating intercellular adhesion molecule-1 expression on murine peritoneal macrophage infected with M. leprae. Int. I. Lepr. 67(1999)36-45.
24. Sibling, P. A.. Ahrams. J. S., Yamamura, M.. Sai.ga.me. P., Bloom. B. R., Ri a. T. H. and Modlin. R. L. Immunosuppressive roles for mter-leukin-10 and interleukin-4 in human infections: in vitro modulation of Tcell responses in leprosy. J. Immunol. 150(1993)5501-5510.
25. Sibling. P. A.. Sakimura, L., Uyemura. K., Yamamura, M., Oliveros. J. L., Nickoloff, B. J., Rea, T. H. and Modlin, R. L. IL-7 in ihe cell-mediated immune response to a human pathogen. J. Immunol. 164(1995)2775-2783.
26. Sibling. P. A., Wang, X-H., Gaiely, M. K.. Oliveros, j. L., McHugh, T, Barnes, P. F.. Wolf, S. F., Golkar, L., Yamamura, M.. Yogi, Y. Uyemura, K., Rea. T. H. and Modlin. R. L. 1L-12 regulates T helper type I cytokine responses in human infectious disease. J Immunol. 163 (1994) 3639-3647.
27. Smida, J., Kazda, J. and Stackebrandt, E. Molecular-genetic evidence for the relationship of Mycobacterium leprae to slow-growing pathogenic mycobacteria. Int. J. Lepr. 56 (1988) 449-454.
28. Thole, J. E.. Wieles, B.. Clark-Curtiss. J. E., Ottenhoff, T. H. and de Wit, T. F. Immunological and functional characterization of Mycobacterium leprae antigen: an overview. Mol. Microbiol. 18(1995) 791-800.
29. Tomioka, H. Changes in cytokine profiles induced by the infection with leprosy bacilli. Clin. Immunol. Tokyo 34 (2000) 145-152.
30. Tomioka, H., Shimizu, T, Maw, W. W. and Ogasawara, K. Roles of tumour necrosis factor-alpha (TNF-a) in the modulation of intercellular adhesion molecule-1 (ICAM-I) expression by macrophages during mycobacterial infection. Clin. Exp. Immunol. 122 (2000) 335-342.
31. Triccas, J. E., Winter, N., Roche, P. W., Gilpin, P. W.. Kendrick, K. E. and Britton, W. J. Molecular and immunological analyses of the Mycobacterium avium homolog of the immunodominant Mycobacterium leprae 35-kilodalton protein. Infect. Immun. 66 (1998) 2684-2690.
32. Tsukiyama, F., Katoh, M., Nomura, T. and Matsuo, Y. Use of the fluorescent staining method for determining the viability of Mycobacterium lepraemurium. Hiroshima J. Med. Sci. 34 (1985) 161-163.
33. Yamamura, M., Uyemura, K., Deans, R. J., Weinberg, K., Rea, T. H., Bloom, B. R. and Modlin, R. L. Defining protective response to pathogens: cytokine profiles in leprosy lesions. Science 254 (1991) 277-279.
1. M.S., Department of Microbiology and Immunology, Shimane Medical University, Izumo, Shimane 693-8501, Japan.
2. M.D., Department of Microbiology and Immunology, Shimane Medical University, Izumo, Shimane 693-8501, Japan.
3. Ph.D., Department of Microbiology and Immunology, Shimane Medical University, Izumo, Shimane 693-8501, Japan.
4. Ph.D., Leprosy Research Center, National Institute of Infectious Diseases, Tokyo, Japan.
Reprint requests to:
Dr. H. Tomioka
at the above address or Fax: 81-853-20-2145
E-mail: tomioka@shimane-med.ac.jp
Received for publication on 18 June 2001.
Accepted for publication on 7 October 2002.